Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDAS12230_pegRNA-PEAR-GFP(10PBS-24RT)-mCherry
(Plasmid #177182)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 177182 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC19
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pegRNA targeting the PEAR-GFP plasmid
  • gRNA/shRNA sequence
    GAATGTCAAACCCGCAGTCT
  • Species
    Synthetic; S. pyogenes
  • Promoter U6

Cloning Information

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDAS12230_pegRNA-PEAR-GFP(10PBS-24RT)-mCherry was a gift from Ervin Welker (Addgene plasmid # 177182 ; http://n2t.net/addgene:177182 ; RRID:Addgene_177182)
  • For your References section:

    PEAR, a flexible fluorescent reporter for the identification and enrichment of successfully prime edited cells. Simon DA, Talas A, Kulcsar PI, Biczok Z, Krausz SL, Varady G, Welker E. Elife. 2022 Feb 23;11. pii: 69504. doi: 10.7554/eLife.69504. 10.7554/eLife.69504 PubMed 35196219