pMax_ScaI_BFP
(Plasmid
#177824)
-
PurposeSite-specific mutagenesis of tagBFP for the purposes of creating a clean double strand break for the purposes of measuring NHEJ activity via Host Cell Reactivation (HCR).
-
Depositing Labs
-
Depositing OrganizationMassachusetts Institute of Technology
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177824 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 177824-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 177824-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepMax
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametagBFP
-
SpeciesSynthetic
-
Insert Size (bp)702
-
Mutation5' inserted ScaI RE cut site
- Promoter CMV
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GCAATAGCATCACAAATTTCACA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information, see Piett, Pecen et al. 2021 Nat Protoc. (doi: 10.1038/s41596-021-00577-3).
DNA (Catalog # 177824-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 177824-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMax_ScaI_BFP was a gift from Zachary Nagel & Leona Samson (Addgene plasmid # 177824 ; http://n2t.net/addgene:177824 ; RRID:Addgene_177824) -
For your References section:
Multiplexed DNA repair assays for multiple lesions and multiple doses via transcription inhibition and transcriptional mutagenesis. Nagel ZD, Margulies CM, Chaim IA, McRee SK, Mazzucato P, Ahmad A, Abo RP, Butty VL, Forget AL, Samson LD. Proc Natl Acad Sci U S A. 2014 May 6;111(18):E1823-32. doi: 10.1073/pnas.1401182111. Epub 2014 Apr 22. 10.1073/pnas.1401182111 PubMed 24757057