pMax_mPlum
(Plasmid #177830)

• Purpose: Host Cell Reactivation (HCR) control mPlum plasmid (pMax backbone)
• Depositing Labs: Zachary Nagel, Leona Samson
• Publication: Nagel et al Proc Natl Acad Sci U S A. 2014 May 6;111(18):E1823-32. doi: 10.1073/pnas.1401182111. Epub 2014 Apr 22.

Backbone

• Vector backbone: pMax
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mPlum
• Species: Synthetic
• Insert Size (bp): 681
• Promoter: CMV

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: GCAATAGCATCACAAATTTCACA

Resource Information

• Supplemental Documents:
  • pmax_mPlum.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For more information, see Piett, Pecen et al. 2021 Nat Protoc. (doi: 10.1038/s41596-021-00577-3).

This plasmid has been found to be prone to multimerization. Multimerization often does not impact plasmid function, but it may reduce transformation efficiencies. If you need to isolate the monomeric version, you might consider linearizing, gel extracting, re-ligating, and transforming the plasmid.