DL017:CMV::HaloTag-iPAK4
(Plasmid #177882)

• Purpose: HT-iPAK4 fusion with CMV promoter, cloned into a lentivirus backbone
• Depositing Lab: Adam Cohen
• Publication: Lin et al Nat Biotechnol. 2023 Jan 2. doi: 10.1038/s41587-022-01524-7.

Backbone

• Vector backbone: pLenti CMV
• Total vector size (bp): 10509
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: iPAK4
• Species: Synthetic
• Insert Size (bp): 1971
• Promoter: CMV
• Tag / Fusion Protein:
  • HaloTag (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TTTCGGGTTTATTACAGGGACAG
• 3′ sequencing primer: GATATCGAATTCTCATCTGGTGCG

Resource Information

• Supplemental Documents:
  • DL017_pLenti_CMV_Halotag_iBox38_PAK4cat Copy.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • HaloTag Vector Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note: Plasmid contains a T135I mutation in the Halo Tag. This mutation is not known to affect protein function.