pMSCV Cdk2ap1ΔN (MT2B2)-HA
(Plasmid #178031)

• Purpose: Retroviral vector for the purpose of overexpression in mammalian cell culture
• Depositing Lab: Lin He
• Publication: Modzelewski et al Cell. 2021 Oct 7. pii: S0092-8674(21)01104-1. doi: 10.1016/j.cell.2021.09.021.

Backbone

• Vector backbone: pMSCV PIG (Puro IRES GFP empty vector)
• Backbone manufacturer: David Bartel
• Backbone size w/o insert (bp): 7657
• Total vector size (bp): 7977
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cdk2ap1
• Alt name: Cdk2ap1 Chimeric
• Species: M. musculus (mouse)
• Insert Size (bp): 261
• Mutation: First N-Terminal 27aa are deleted
• GenBank ID: 13445
• Entrez Gene: Cdk2ap1 (a.k.a. Apc10, Cdkap1, DORC1, Doc1, ST19, doc-1, p12)
• Promoter: GAG
• Tag / Fusion Protein:
  • HA (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XHO1 (not destroyed)
• 3′ cloning site: EcoRi (not destroyed)
• 5′ sequencing primer: cccttgaacctcctcgttcgacc
• 3′ sequencing primer: gagacgtgctacttccatttgt

Resource Information

• Supplemental Documents:
  • pMSCV Cdk2ap1ΔN (MT2B2)-HA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry