pAAV-UBC-ERT2-iCre-ERT2
(Plasmid
#178060)
-
PurposeConditionally active form of Cre recombinase (activated in response to tamoxifen) under UBC promoter.
-
Depositing Lab
-
Depositing OrganizationMassachusetts Institute of Technology
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178060 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-UBC
-
Backbone manufacturerEpoch Life Science, Inc.
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameERT2-iCre-ERT2
-
SpeciesSynthetic
-
Insert Size (bp)2922
- Promoter Human ubiquitin C (UBC) promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GATCGCTGTGATCGTCACTTGG
- 3′ sequencing primer WPRE-R
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The gene ERT2-iCre-ERT2 in this plasmid is the mamalian-codon optimized version of the gene ERT2CreERT2 in Addgene Plasmid #13777 (pCAG-ERT2CreERT2). Please visit https://www.biorxiv.org/content/10.1101/2021.10.13.464006v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-UBC-ERT2-iCre-ERT2 was a gift from Edward Boyden (Addgene plasmid # 178060 ; http://n2t.net/addgene:178060 ; RRID:Addgene_178060) -
For your References section:
Recording of cellular physiological histories along optically readable self-assembling protein chains. Linghu C, An B, Shpokayte M, Celiker OT, Shmoel N, Zhang R, Zhang C, Park D, Park WM, Ramirez S, Boyden ES. Nat Biotechnol. 2023 Jan 2. doi: 10.1038/s41587-022-01586-7. 10.1038/s41587-022-01586-7 PubMed 36593405