Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-UBC-FLEX-XRI-FLAG
(Plasmid #178057)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 178057 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-UBC-FLEX
  • Backbone manufacturer
    Epoch Life Science, Inc.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    XRI-FLAG
  • Alt name
    1POK(E239Y)-Linker25-FLAG-Linker3-MBP tag
  • Species
    Synthetic
  • Insert Size (bp)
    2376
  • Promoter Human ubiquitin C (UBC) promoter
  • Tag / Fusion Protein
    • FLAG-MBP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GATCGCTGTGATCGTCACTTGG
  • 3′ sequencing primer GCAAACAACAGATGGCTGGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-UBC-FLEX-XRI-FLAG was a gift from Edward Boyden (Addgene plasmid # 178057 ; http://n2t.net/addgene:178057 ; RRID:Addgene_178057)
  • For your References section:

    Recording of cellular physiological histories along optically readable self-assembling protein chains. Linghu C, An B, Shpokayte M, Celiker OT, Shmoel N, Zhang R, Zhang C, Park D, Park WM, Ramirez S, Boyden ES. Nat Biotechnol. 2023 Jan 2. doi: 10.1038/s41587-022-01586-7. 10.1038/s41587-022-01586-7 PubMed 36593405