Skip to main content

pSmart-EF1a-Nla-cas5
(Plasmid #178878)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178878 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 178878-D50 50 μg of DNA in Tris buffer $495
DNA 178878-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pSmart HC Kan
  • Backbone manufacturer
    Lucigen
  • Backbone size w/o insert (bp) 1984
  • Total vector size (bp) 4093
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EF1a-NlaCas5c-bGH polyA
  • Species
    Synthetic
  • Insert Size (bp)
    2109
  • Promoter EF1a
  • Tags / Fusion Proteins
    • HA (C terminal on insert)
    • NLS (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGGTCAGTATTGAGCGATATCTAGA
  • 3′ sequencing primer CAGTCCAGTTACGCTGGAGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSmart-EF1a-Nla-cas5 was a gift from Yan Zhang (Addgene plasmid # 178878 ; http://n2t.net/addgene:178878 ; RRID:Addgene_178878)
  • For your References section:

    Cas11 enables genome engineering in human cells with compact CRISPR-Cas3 systems. Tan R, Krueger RK, Gramelspacher MJ, Zhou X, Xiao Y, Ke A, Hou Z, Zhang Y. Mol Cell. 2022 Feb 17;82(4):852-867.e5. doi: 10.1016/j.molcel.2021.12.032. Epub 2022 Jan 19. 10.1016/j.molcel.2021.12.032 PubMed 35051351