Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pSmart HC Kan-U6-Nla-repeat-BbsI-Nla-repeat
(Plasmid #178883)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 178883 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSmart HC Kan
  • Backbone manufacturer
    Lucigen
  • Backbone size w/o insert (bp) 1812
  • Total vector size (bp) 2166
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    U6-Nla repeat-BbsI-Nla repeat
  • gRNA/shRNA sequence
    n/a
  • Species
    Synthetic
  • Promoter U6

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CAGTCCAGTTACGCTGGAGTC
  • 3′ sequencing primer GGTCAGGTATGATTTAAATGGTCAGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSmart HC Kan-U6-Nla-repeat-BbsI-Nla-repeat was a gift from Yan Zhang (Addgene plasmid # 178883 ; http://n2t.net/addgene:178883 ; RRID:Addgene_178883)
  • For your References section:

    Cas11 enables genome engineering in human cells with compact CRISPR-Cas3 systems. Tan R, Krueger RK, Gramelspacher MJ, Zhou X, Xiao Y, Ke A, Hou Z, Zhang Y. Mol Cell. 2022 Feb 17;82(4):852-867.e5. doi: 10.1016/j.molcel.2021.12.032. Epub 2022 Jan 19. 10.1016/j.molcel.2021.12.032 PubMed 35051351