Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAd5-B6/7 ∆E3-GFP
(Plasmid #179202)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 179202 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pJet1.2
  • Backbone manufacturer
    ThermoFisher Scientific
  • Backbone size w/o insert (bp) 2988
  • Total vector size (bp) 12877
  • Vector type
    Adenoviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Modified block 6/7, with deletion in E3 and insertion of GFP cassette
  • Species
    Adenovirus 5
  • Insert Size (bp)
    9889
  • GenBank ID
    NC_001405

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (unknown if destroyed)
  • 3′ cloning site EcoRV (unknown if destroyed)
  • 5′ sequencing primer CGACTCACTATAGGGAGAGCGGC
  • 3′ sequencing primer AAGAACATCGATTTTCCATGGCAG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAd5-B6/7 ∆E3-GFP was a gift from Fred Bunz (Addgene plasmid # 179202 ; http://n2t.net/addgene:179202 ; RRID:Addgene_179202)
  • For your References section:

    AdenoBuilder: A platform for the modular assembly of recombinant adenoviruses. Jang Y, Bunz F. STAR Protoc. 2022 Jan 20;3(1):101123. doi: 10.1016/j.xpro.2022.101123. eCollection 2022 Mar 18. 10.1016/j.xpro.2022.101123 PubMed 35098167