pPOLY_new
(Plasmid #179276)

• Purpose: Expresses CuCBP, CcCDP and BaSP tricistronically in E. coli BL21(DE3)
• Depositing Lab: Bernd Nidetzky
• Publication: Schwaiger et al Microb Cell Fact. 2022 Apr 9;21(1):61. doi: 10.1186/s12934-022-01781-w.

Backbone

• Vector backbone: self assembled
• Backbone size w/o insert (bp): 3464
• Total vector size (bp): 10400
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Expression at 25°C
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: cellodextrin phosphorylase
• Species: Clostridium cellulosi
• Insert Size (bp): 2991
• GenBank ID: CDZ24361.1 CDZ24361.1
• Promoter: T7 lacO
• Tag / Fusion Protein:
  • 6xHIS (N terminal on backbone)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATGACAACATCCTGGAAGCG
• 3′ sequencing primer: CGGCATTATGGTTGACACCC

Gene/Insert 2

• Gene/Insert name: cellobiose phosphorylase
• Species: Cellulomonas uda
• Insert Size (bp): 2463
• GenBank ID: AAQ20920.1
• Promoter: T7 lacO
• Tag / Fusion Protein:
  • 6xHIS (N terminal on backbone)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: taatacgactcactatagg
• 3′ sequencing primer: CCAAAGTGACCCCGCGTAGCTGC

Gene/Insert 3

• Gene/Insert name: sucrose phosphorylase
• Species: Bifidobacterium alodescentis
• Insert Size (bp): 1515
• GenBank ID: AF543301.1
• Entrez Gene: C8077_RS00435 (a.k.a. C8077_RS00435, C8077_00435)
• Promoter: T7 lacO
• Tag / Fusion Protein:
  • Strep-Tag II (N terminal on backbone)

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: aacccctcaagacccg
• 3′ sequencing primer: CTGCGCGAAGAAGGCGTG

Resource Information

• Supplemental Documents:
  • pPOLY_new.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry