pHsSyx3-MBP
(Plasmid #179286)

• Purpose: E. coli expression plasmid (T7 promoter) for expression-optimized DNA of human Syx (aa 393-792) with C-terminal TEV protease cleavage site + mature maltose binding protein + His6
• Depositing Lab: Debra Hansen
• Publication: Boyd et al FASEB J. 2022 Jul;36(7):e22378. doi: 10.1096/fj.202101808RR.

Backbone

• Vector backbone: pET MBP His6 LIC (2Cc-T), Addgene # 37237
• Backbone manufacturer: Addgene
• Backbone size w/o insert (bp): 5900
• Total vector size (bp): 7102
• Modifications to backbone: none
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Syx
• Alt name: synectin-binding guanine exchange factor
• Alt name: pleckstrin homology domain-containing family G member 5 isoform c
• Alt name: PLEKHG5; CMTRIC; DSMA4; GEF720; Tech
• Species: H. sapiens (human)
• Insert Size (bp): 1200
• Mutation: residues 393-792 from accession number NP_001036128.1; optimized DNA sequence
• GenBank ID: NP_001036128.1
• Promoter: T7
• Tag / Fusion Protein:
  • TEV protease cleavage site + mature maltose binding protein + His6 (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HpaI (destroyed during cloning)
• 3′ cloning site: HpaI (destroyed during cloning)
• 5′ sequencing primer: T7, TAATACGACTCACTATAGGG
• 3′ sequencing primer: 37237 seq R, GTGACTTTAATTCCGGTATCTTTCTCG

Resource Information

• Supplemental Documents:
  • pHsSyx3-MBP.gb
• A portion of this plasmid was derived from a plasmid made by: The insert had been ordered from GenScript as an E. coli expression-optimized synthetic DNA.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Protein sequence is Met + human Syx (synectin-binding guanine exchange factor; aa 393-792 from accession number NP_001036128.1) + TEV protease cleavage (ENLYFQ*S; * = cleavage site) + GSSGSM + maltose binding protein (aa 27-393 of AAB59056) + GSS + HHHHHH.
Confers ampicillin-resistance.
Backbone vector is pET MBP His6 LIC (2Cc-T) Addgene # 37237.
Construct design by Ryan Boyd and Debra T. Hansen.
Cloning by Felicia M. Craciunescu.
Preprint: Boyd et al., bioRxiv 2021.08.26.457821, https://doi.org/10.1101/2021.08.26.457821