Skip to main content
Addgene
Open Menu

pEGFP-hCB2R
(Plasmid #179322)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179322 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 179322-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 179322-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pEGFP-N1
  • Total vector size (bp) 5781
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    human cannabinoid 2 receptor
  • Alt name
    CB2R
  • Alt name
    CNR2
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_001841.3 1269
  • Entrez Gene
    CNR2 (a.k.a. CB-2, CB2, CX5)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GAGGTCTATATAAGCAGAGC
  • 3′ sequencing primer ACTTGTGGCCGTTTACGTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-hCB2R was a gift from Christian Gruber (Addgene plasmid # 179322 ; http://n2t.net/addgene:179322 ; RRID:Addgene_179322)

  • For your References section:

    Discovery and development of macrocyclic peptide modulators of the cannabinoid 2 receptor. Tomašević N, Emser FS, Muratspahic E, Gattringer J, Hasinger S, Hellinger R, Keov P, Felkl M, Gertsch J, Becker CFW, Gruber CW. J Biol Chem. 2024 Jun;300(6):107330. doi: 10.1016/j.jbc.2024.107330. Epub 2024 Apr 26. 10.1016/j.jbc.2024.107330 PubMed 38679329
Related items:
Commonly requested with: