ePB-PURO-TT-PA-CRE
(Plasmid
#179584)
-
PurposeePiggyBac vector to conditionally express using DOX a light-inducible Cre-recombinase enzyme that takes advantage of the Magnets dimerization system (Magnet-CRE)
-
Depositing Lab
-
Depositing OrganizationRockefeller University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179584 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 179584-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 179584-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneKS(-)
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePA-MAG-CRE
- Promoter TRE
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer CGTATGTCGAGTTTACTCCC
- 3′ sequencing primer gttaacaacaacaattgcattc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 179584-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 179584-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ePB-PURO-TT-PA-CRE was a gift from Ali Hemmati Brivanlou (Addgene plasmid # 179584 ; http://n2t.net/addgene:179584 ; RRID:Addgene_179584) -
For your References section:
Self-organization of human dorsal-ventral forebrain structures by light induced SHH. De Santis R, Etoc F, Rosado-Olivieri EA, Brivanlou AH. Nat Commun. 2021 Nov 19;12(1):6768. doi: 10.1038/s41467-021-26881-w. 10.1038/s41467-021-26881-w PubMed 34799555
Map uploaded by the depositor.
