Skip to main content

M8
(Plasmid #180253)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 180253 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 180253-D50 50 μg of DNA in Tris buffer $495
DNA 180253-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pTK1-TPA
  • Backbone size w/o insert (bp) 4967
  • Total vector size (bp) 5638
  • Vector type
    Mammalian Expression ; vaccine vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Synthetic gene encoding for 8 neonatigens specific for MC38 mouse cancer cells
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    696
  • Mutation
    the polyepitope vaccine encodes for mutated sequence expressed in the MC38 tumor model
  • GenBank ID
    NM_001359282.1
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer GAGGGCAGTGTAGTCTGAGCAGTACTCG
  • 3′ sequencing primer GGACAGTGGGAGTGGCACCTTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    M8 was a gift from Fabio Palombo (Addgene plasmid # 180253 ; http://n2t.net/addgene:180253 ; RRID:Addgene_180253)
  • For your References section:

    Neoantigen cancer vaccine augments anti-CTLA-4 efficacy. Salvatori E, Lione L, Compagnone M, Pinto E, Conforti A, Ciliberto G, Aurisicchio L, Palombo F. NPJ Vaccines. 2022 Feb 2;7(1):15. doi: 10.1038/s41541-022-00433-9. 10.1038/s41541-022-00433-9 PubMed 35110563