M8
(Plasmid
#180253)
-
PurposeVaccine vector encoding 8 neonatigens specific for the MC38 colon cancer mouse model
-
Depositing Lab
-
Depositing OrganizationTakis Biotech
Located in Italy -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 180253 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 180253-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 180253-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepTK1-TPA
- Backbone size w/o insert (bp) 4967
- Total vector size (bp) 5638
-
Vector typeMammalian Expression ; vaccine vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSynthetic gene encoding for 8 neonatigens specific for MC38 mouse cancer cells
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)696
-
Mutationthe polyepitope vaccine encodes for mutated sequence expressed in the MC38 tumor model
-
GenBank IDNM_001359282.1
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer GAGGGCAGTGTAGTCTGAGCAGTACTCG
- 3′ sequencing primer GGACAGTGGGAGTGGCACCTTCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 180253-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 180253-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
M8 was a gift from Fabio Palombo (Addgene plasmid # 180253 ; http://n2t.net/addgene:180253 ; RRID:Addgene_180253) -
For your References section:
Neoantigen cancer vaccine augments anti-CTLA-4 efficacy. Salvatori E, Lione L, Compagnone M, Pinto E, Conforti A, Ciliberto G, Aurisicchio L, Palombo F. NPJ Vaccines. 2022 Feb 2;7(1):15. doi: 10.1038/s41541-022-00433-9. 10.1038/s41541-022-00433-9 PubMed 35110563