pCAG1.1-Armc12 delta C/FLAG
(Plasmid #180497)

• Purpose: Expression vector of C-terminal deleted mouse Armc12 tagged with FLAG at C-terminus. See Fig.4D of Shimada, K. et al. Proc. Natl. Acad. Sci. USA. 118 (6): e2018355118, 2021.
• Depositing Lab: Masahito Ikawa
• Publication: Shimada et al Proc Natl Acad Sci U S A. 2021 Feb 9;118(6). pii: 2018355118. doi: 10.1073/pnas.2018355118.

Backbone

• Vector backbone: pCAG1.1
• Backbone size w/o insert (bp): 5184
• Total vector size (bp): 5184
• Modifications to backbone: pCAG1.1 was used as an original vector. FLAG tag sequence was added.
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: armadillo repeat containing 12
• Alt name: Armc12
• Species: M. musculus (mouse)
• Insert Size (bp): 957
• Mutation: C-terminus of Armc12 is deleted
• GenBank ID: NM_026290.3
• Entrez Gene: Armc12 (a.k.a. 4930511I11Rik, AV041658)
• Promoter: CAG promoter
• Tag / Fusion Protein:
  • FLAG tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PstI (not destroyed)
• 3′ cloning site: EcoRV (not destroyed)
• 5′ sequencing primer: GTTCGGCTTCTGGCGTGTGA
• 3′ sequencing primer: ATAAATTTCCTTTATTAGCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry