Skip to main content

pOC1 Halo-Actb KI
(Plasmid #183426)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183426 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 183426-D50 50 μg of DNA in Tris buffer $495
DNA 183426-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pOC1
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA and Halo donor
  • gRNA/shRNA sequence
    TGTGCCTTGATAGTTCGCCA
  • Species
    R. norvegicus (rat)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer ctagtccgtttttagcgcgt
  • 3′ sequencing primer cgggccatttaccgtaagtt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOC1 Halo-Actb KI was a gift from Harold MacGillavry (Addgene plasmid # 183426 ; http://n2t.net/addgene:183426 ; RRID:Addgene_183426)
  • For your References section:

    Duplex Labeling and Manipulation of Neuronal Proteins Using Sequential CRISPR/Cas9 Gene Editing. Droogers WJ, Willems J, MacGillavry HD, de Jong APH. eNeuro. 2022 Jul 18;9(4):ENEURO.0056-22.2022. doi: 10.1523/ENEURO.0056-22.2022. 10.1523/ENEURO.0056-22.2022 PubMed 35851300