pFUGW-shRIIα-RIIαS97E-IRES-EGFP
(Plasmid #183458)

• Purpose: Replacement of endogenous rat PKA-RIIα subunits with the RIIα S97E variant
• Depositing Lab: Matthew Gold
• Publication: Church et al Elife. 2021 Oct 6;10. pii: 68164. doi: 10.7554/eLife.68164.

Backbone

• Vector backbone: pFUGW-H1 empty vector
• Backbone manufacturer: pFUGW-H1 empty vector was a gift from Sally Temple (Addgene plasmid # 25870 ; http://n2t.net/addgene:25870 ; RRID:Addgene_25870)
• Backbone size w/o insert (bp): 10130
• Vector type: Lentiviral
• Selectable markers: Zeocin ; GFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: sgRNA and Prkar2a
• Alt name: cAMP-dependent protein kinase type II-alpha regulatory subunit
• gRNA/shRNA sequence: GCCAGGAATCAGACTCGTTCA
• Species: R. norvegicus (rat)
• Mutation: shRNA-resistant mutations: C135>G, G138>A, A141>G. Phosphomimetic: S97E
• Entrez Gene: Prkar2a
• Promoter: shRNA: H1 / gene: ubiquitin

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: GOI: AgeI (not destroyed)
• 3′ cloning site: GOI: NheI (not destroyed)
• 5′ sequencing primer: shRNA (H1) - 5'tcgctatgtgttctgggaaa; Prkar2a_bp500_F - 5'GAGATGATGGAGACAACTTTTATGTC; Prkar2a_bp1000_F - 5'GGAGAACTTGCCCTGGTGACCA
• 3′ sequencing primer: 5'GTTCAGGGGGAGGTGT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: We amplified the RIIα coding sequence from a rat hippocampal cDNA library.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Zeo marker is outside the LTRs and will not be packaged into virus.