pPyCAG-NE-EGFP-IRES-Pac
(Plasmid
#183617)
-
PurposeMammalian expression vector: CAG promoter driving expression of nuclear envelope-tethered EGFP (NLS-EGFP-EmerinTMD). Confers puromycin resistance.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 183617 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepPyCAG-IRES-Pac
- Backbone size w/o insert (bp) 6421
- Total vector size (bp) 7425
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP
-
SpeciesSynthetic
-
Insert Size (bp)1004
- Promoter CAG
-
Tags
/ Fusion Proteins
- NLS (N terminal on insert)
- Human EMD transmembrane domain (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TGCTGGTTGTTGTGCTGT
- 3′ sequencing primer CGCACACCGGCCTTATTCCA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPyCAG-NE-EGFP-IRES-Pac was a gift from Sally Lowell (Addgene plasmid # 183617 ; http://n2t.net/addgene:183617 ; RRID:Addgene_183617) -
For your References section:
Id1 Stabilizes Epiblast Identity by Sensing Delays in Nodal Activation and Adjusting the Timing of Differentiation. Malaguti M, Migueles RP, Blin G, Lin CY, Lowell S. Dev Cell. 2019 Jun 11. pii: S1534-5807(19)30445-9. doi: 10.1016/j.devcel.2019.05.032. 10.1016/j.devcel.2019.05.032 PubMed 31204172