pC28-LIC-sfGFP-His
(Plasmid
#165479)
-
Purpose(Empty Backbone) pET based vector for protein expression in E.coli for targets fused with C-terminal superfolder GFP and His tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 165479 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET28
-
Backbone manufacturerNovagen
-
Vector typeBacterial Expression
-
Tag
/ Fusion Protein
- TEV-GFP-6xHis (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNone
-
Tag
/ Fusion Protein
- TEV-GFP-6xHis (C terminal on backbone)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Primers for LIC cloning: Upstream: add TTAAGAAGGAGATATACT to the 5' end of gene of interest. Downstream: add TGAAAATAGAGGTTTTCGGC to the 3' end of GOI. Detailed cloning method available in the paper Bruni R, Kloss B. High-throughput cloning and expression of integral membrane proteins in Escherichia coli. Curr Protoc Protein Sci. 2013 Nov 5;74:29.6.1-29.6.34.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC28-LIC-sfGFP-His was a gift from Renato Bruni (Addgene plasmid # 165479 ; http://n2t.net/addgene:165479 ; RRID:Addgene_165479) -
For your References section:
High-throughput cloning and expression of integral membrane proteins in Escherichia coli. Bruni R, Kloss B. Curr Protoc Protein Sci. 2013 Nov 5;74:29.6.1-29.6.34. doi: 10.1002/0471140864.ps2906s74. 10.1002/0471140864.ps2906s74 PubMed 24510647
Map uploaded by the depositor.
