Skip to main content

pSLQ10713
(Plasmid #183958)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183958 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 183958-D50 50 μg of DNA in Tris buffer $495
DNA 183958-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pUC
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    HyperdCas12a
  • Alt name
    LbdCas12a(D156R, E292R, D235R, D350R)
  • Alt name
    LbdCfp1(D156R, E292R, D235R, D350R)
  • Species
    Synthetic
  • Mutation
    D832A, D156R, E292R, D235R, D350R
  • Promoter CAG
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGCAAAGAATTCTGCAGTCGACGGTACC
  • 3′ sequencing primer TTTTGGCAGAGGGAAAAAGA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    crRNA targeting Sox2
  • Species
    Synthetic
  • Promoter U6

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACGATACAAGGCTGTTAGAGAG
  • 3′ sequencing primer gcggccgcctaatggatccctcgag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ10713 was a gift from Stanley Qi (Addgene plasmid # 183958 ; http://n2t.net/addgene:183958 ; RRID:Addgene_183958)
  • For your References section:

    Multiplexed genome regulation in vivo with hyper-efficient Cas12a. Guo LY, Bian J, Davis AE, Liu P, Kempton HR, Zhang X, Chemparathy A, Gu B, Lin X, Rane DA, Xu X, Jamiolkowski RM, Hu Y, Wang S, Qi LS. Nat Cell Biol. 2022 Apr;24(4):590-600. doi: 10.1038/s41556-022-00870-7. Epub 2022 Apr 12. 10.1038/s41556-022-00870-7 PubMed 35414015