pUltra-Hot-PC
(Plasmid #184466)

• Purpose: Lentiviral vector for bi-cistronic expression of mCherry and PC (seperated by P2A)
• Depositing Lab: Gerardo Ferbeyre
• Publication: Igelmann et al Mol Cell. 2021 Sep 16;81(18):3848-3865.e19. doi: 10.1016/j.molcel.2021.08.028.

Backbone

• Vector backbone: pUltra-Hot
• Backbone manufacturer: obtained from Addgene (#24130)
• Backbone size w/o insert (bp): 8317
• Total vector size (bp): 11770
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: mCherry

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Pyruvate Carboxylase
• Species: H. sapiens (human)
• Insert Size (bp): 3537
• GenBank ID: NM_000920
• Entrez Gene: PC (a.k.a. PCB)
• Promoter: UbC

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ggatctggagcaacaaacttc
• 3′ sequencing primer: gtatccacatagcgtaaaagg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The sequence for PC was from OriGene CAT#: SC122580

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry