pN1-CMV-H-sDarken
(Plasmid
#184800)
-
PurposeHigh affinity version of the Serotonin Sensor sDarken under the control of a CMV Promoter.
-
Depositing Lab
-
Depositing OrganizationUniversitaet Bremen
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184800 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 184800-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 184800-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepN1
- Backbone size w/o insert (bp) 3961
- Total vector size (bp) 5641
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH-sDarken
-
SpeciesSynthetic
-
Insert Size (bp)1680
-
GenBank ID
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GCAAATGGGCGGTAGGCGT
- 3′ sequencing primer AACCATTATAAGCTGCAATAAAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.03.10.483799 for bioRxiv preprint.
DNA (Catalog # 184800-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 184800-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pN1-CMV-H-sDarken was a gift from Olivia Masseck (Addgene plasmid # 184800 ; http://n2t.net/addgene:184800 ; RRID:Addgene_184800) -
For your References section:
Next generation genetically encoded fluorescent sensors for serotonin. Kubitschke M, Muller M, Wallhorn L, Pulin M, Mittag M, Pollok S, Ziebarth T, Bremshey S, Gerdey J, Claussen KC, Renken K, Gross J, Gneisse P, Meyer N, Wiegert JS, Reiner A, Fuhrmann M, Masseck OA. Nat Commun. 2022 Dec 6;13(1):7525. doi: 10.1038/s41467-022-35200-w. 10.1038/s41467-022-35200-w PubMed 36473867