Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pN1-CMV-sDarken
(Plasmid #184799)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 184799 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pN1
  • Backbone size w/o insert (bp) 3961
  • Total vector size (bp) 5641
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sDarken
  • Species
    Synthetic
  • Insert Size (bp)
    1680
  • GenBank ID
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GCAAATGGGCGGTAGGCGT
  • 3′ sequencing primer AACCATTATAAGCTGCAATAAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2022.03.10.483799 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pN1-CMV-sDarken was a gift from Olivia Masseck (Addgene plasmid # 184799 ; http://n2t.net/addgene:184799 ; RRID:Addgene_184799)
  • For your References section:

    Next generation genetically encoded fluorescent sensors for serotonin. Kubitschke M, Muller M, Wallhorn L, Pulin M, Mittag M, Pollok S, Ziebarth T, Bremshey S, Gerdey J, Claussen KC, Renken K, Gross J, Gneisse P, Meyer N, Wiegert JS, Reiner A, Fuhrmann M, Masseck OA. Nat Commun. 2022 Dec 6;13(1):7525. doi: 10.1038/s41467-022-35200-w. 10.1038/s41467-022-35200-w PubMed 36473867