Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed November 28th & 29th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of November 25th - 29th. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #126475)


Item Catalog # Description Quantity Price (USD)
Plasmid 126475 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size (bp) 4111
  • Modifications to backbone
    The promoter, multiple cloning site and termination regions have been replaced with the bidirectional expression cassette of the pBI-CMV1 vector (Clontech)
  • Vector type
    Mammalian Expression
  • Promoter CMV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GGGGTCATTAGTTCATAGCCCATAT
  • 3′ sequencing primer CAAAACCGCATCACCATGGTAATAG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please visit for BioRxiv preprint

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-BI was a gift from Bill Hansson (Addgene plasmid # 126475 ; ; RRID:Addgene_126475)
  • For your References section:

    Optimization of Insect Odorant Receptor Trafficking and Functional Expression Via Transient Transfection in HEK293 Cells. Miazzi F, Hoyer C, Sachse S, Knaden M, Wicher D, Hansson BS, Lavista-Llanos S. Chem Senses. 2019 Oct 26;44(9):673-682. doi: 10.1093/chemse/bjz062. 10.1093/chemse/bjz062 PubMed 31504297