Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pcDNA5-FRT-GFP-mCherry-3pGW
(Plasmid #53965)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 53965 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA5/FRT
  • Backbone manufacturer
    Life Technologies
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Growth instructions
    CmlR
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    GFP
  • Promoter CMV

Cloning Information for Gene/Insert 1

  • Cloning method TOPO Cloning
  • 5′ sequencing primer ATTCGCCACCATGGTGAGCAAGG
  • 3′ sequencing primer TCACTTGTACAGCTCATCCATGCC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mCherry
  • Promoter CMV

Cloning Information for Gene/Insert 2

  • Cloning method TOPO Cloning
  • 5′ sequencing primer ATGGTGAGCAAGGGCGAGGAGGATAA
  • 3′ sequencing primer CTTACTTGTACAGCTCGTCCATG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA5-FRT-GFP-mCherry-3pGW was a gift from Saeed Tavazoie (Addgene plasmid # 53965 ; http://n2t.net/addgene:53965 ; RRID:Addgene_53965)
  • For your References section:

    Systematic Identification of Regulatory Elements in Conserved 3' UTRs of Human Transcripts. Oikonomou P, Goodarzi H, Tavazoie S. Cell Rep. 2014 Apr 10;7(1):281-92. doi: 10.1016/j.celrep.2014.03.001. Epub 2014 Mar 20. 10.1016/j.celrep.2014.03.001 PubMed 24656821