Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMedium-FT-N1
(Plasmid #31911)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 31911 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4012
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Medium-FT
  • Alt name
    blue-to-red fluorescent timer
  • Insert Size (bp)
    711
  • Mutation
    M18L/N23D/T43S/K69R/L84W/M152I/Q194L/L205M/Y221C/R227H compared to mCherry (but numbering relative to EGFP)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer cggtaggcgtgtacggtgggag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMedium-FT-N1 was a gift from Vladislav Verkhusha (Addgene plasmid # 31911 ; http://n2t.net/addgene:31911 ; RRID:Addgene_31911)
  • For your References section:

    Monomeric fluorescent timers that change color from blue to red report on cellular trafficking. Subach FV, Subach OM, Gundorov IS, Morozova KS, Piatkevich KD, Cuervo AM, Verkhusha VV. Nat Chem Biol. 2009 Feb;5(2):118-26. Epub 2009 Jan 11. 10.1038/nchembio.138 PubMed 19136976