Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDmelOR-mRho.V5.mER.hOr47a
(Plasmid #126478)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 126478 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCMV-BI
  • Backbone size w/o insert (bp) 4111
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Or47a
  • Alt name
    DmelOr47a
  • Alt name
    Odorant receptor 47a
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    1251
  • Mutation
    codon optimization for H. sapiens
  • Entrez Gene
    Or47a (a.k.a. Dmel_CG13225, 47E.1, 47a, AN10, CG13225, DOR24, DOR47E.1, Dmel\CG13225, OR47a, Or24, Or47E.1, dor24, or47a)
  • Promoter CMV
  • Tags / Fusion Proteins
    • H. sapiens Rhodopsin 344QVAPA348 (mRho) (N terminal on insert)
    • V5 tag (N terminal on insert)
    • H. sapiens HCN1 106VNKFSL111 (mER) (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (destroyed during cloning)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer CATTTTATGTTTCAGGTTCAGGGGG
  • 3′ sequencing primer GGCCTATATAAGCAGAGCTCGTTT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Orco
  • Alt name
    DmelOrco
  • Alt name
    Olfactory receptor co-receptor
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    1509
  • Mutation
    codon optimization for H. sapiens; including a recombinant β-globin/IgG chimeric intron
  • Entrez Gene
    Orco (a.k.a. Dmel_CG10609, 83A.2, 83b, A45, CG10609, DOR45, DOR83b, DmORCO, DmOrco, DmelOrco, Dmel\CG10609, OR49, OR83B, OR83b, ORCO, Or83b, OrCo, or83b, orco, vainsA)
  • Promoter CMV
  • Tag / Fusion Protein
    • Myc (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GTGTACGGTGGGAGGTCTATATAAG
  • 3′ sequencing primer GTGGTATGGCTGATTATGATCCTCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Is it recommended to digest the vector with XhoI and NaeI and gel purify the two bands before sequencing as the two CMV promoters and SV40-polyA sequences are very similar to each other Please visit https://www.biorxiv.org/content/10.1101/669127v1 for BioRxiv preprint

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDmelOR-mRho.V5.mER.hOr47a was a gift from Bill Hansson (Addgene plasmid # 126478 ; http://n2t.net/addgene:126478 ; RRID:Addgene_126478)
  • For your References section:

    Optimization of Insect Odorant Receptor Trafficking and Functional Expression Via Transient Transfection in HEK293 Cells. Miazzi F, Hoyer C, Sachse S, Knaden M, Wicher D, Hansson BS, Lavista-Llanos S. Chem Senses. 2019 Oct 26;44(9):673-682. doi: 10.1093/chemse/bjz062. 10.1093/chemse/bjz062 PubMed 31504297