miniCMV-EGFP-tDeg
(Plasmid
#185400)
-
PurposeEGFP-tDeg fluorogenic protein
-
Depositing Lab
-
Depositing OrganizationHunan University
Located in China -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 185400 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 185400-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 185400-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP-tDeg
-
SpeciesSynthetic
-
MutationWT
- Promoter miniCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer unknown
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 185400-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 185400-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
miniCMV-EGFP-tDeg was a gift from Jian-Hui Jiang (Addgene plasmid # 185400 ; http://n2t.net/addgene:185400 ; RRID:Addgene_185400) -
For your References section:
Genetically Encoded Sensor Enables Endogenous RNA Imaging with Conformation-Switching Induced Fluorogenic Proteins. Zhou WJ, Li H, Zhang KK, Wang F, Chu X, Jiang JH. J Am Chem Soc. 2021 Sep 8;143(35):14394-14401. doi: 10.1021/jacs.1c07719. Epub 2021 Aug 25. 10.1021/jacs.1c07719 PubMed 34431301