Tornado-RNA sensor for MALAT-1
(Plasmid
#185406)
-
Purposecircular RNA-scaffolded sensing modules for MALAT-1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 185406 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAV U6+27
-
Backbone manufacturerAddgene plasmid #129405
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecircular RNA-scaffolded sensing modules
-
SpeciesSynthetic
-
MutationWT
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (unknown if destroyed)
- 3′ cloning site NheI (unknown if destroyed)
- 5′ sequencing primer ccgtaacttgaaagtatttcg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tornado-RNA sensor for MALAT-1 was a gift from Jian-Hui Jiang (Addgene plasmid # 185406 ; http://n2t.net/addgene:185406 ; RRID:Addgene_185406) -
For your References section:
Genetically Encoded Sensor Enables Endogenous RNA Imaging with Conformation-Switching Induced Fluorogenic Proteins. Zhou WJ, Li H, Zhang KK, Wang F, Chu X, Jiang JH. J Am Chem Soc. 2021 Sep 8;143(35):14394-14401. doi: 10.1021/jacs.1c07719. Epub 2021 Aug 25. 10.1021/jacs.1c07719 PubMed 34431301