Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

circRNA-synIRES-R25-NanoLuc
(Plasmid #188116)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 188116 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRC
  • Backbone size w/o insert (bp) 6500
  • Total vector size (bp) 7103
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NanoLuc
  • Species
    Synthetic
  • Insert Size (bp)
    603
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site MfeI (not destroyed)
  • 5′ sequencing primer GGGACGGGACCGACTACTTTGG
  • 3′ sequencing primer CTAGTAGACAATCCCGTGCTAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that this plasmid may run as a dimer or multimer.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    circRNA-synIRES-R25-NanoLuc was a gift from Howard Chang (Addgene plasmid # 188116 ; http://n2t.net/addgene:188116 ; RRID:Addgene_188116)
  • For your References section:

    Engineering circular RNA for enhanced protein production. Chen R, Wang SK, Belk JA, Amaya L, Li Z, Cardenas A, Abe BT, Chen CK, Wender PA, Chang HY. Nat Biotechnol. 2022 Jul 18. pii: 10.1038/s41587-022-01393-0. doi: 10.1038/s41587-022-01393-0. 10.1038/s41587-022-01393-0 PubMed 35851375