Skip to main content
Addgene
Open Menu

fluoPEER-HEK3_5bp-del
(Plasmid #185476)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185476 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 185476-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 185476-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pmGFP-P2A-K0-P2A-RFP
  • Backbone manufacturer
    Ramanujan Hegde
  • Backbone size w/o insert (bp) 5964
  • Total vector size (bp) 5999
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HEK3 editing site
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    59
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site Acc65I (not destroyed)
  • 5′ sequencing primer atgtggcgattctacacagaag
  • 3′ sequencing primer ttggtcaccttcagcttgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The reporter can be used in combination with pegRNA-HEK3_del1-5-NGG with any type of prime editor, which will also edit the HEK3 locus on the human genome. Editing on the reporter will result in mCherry fluorescence.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    fluoPEER-HEK3_5bp-del was a gift from Sabine Fuchs (Addgene plasmid # 185476 ; http://n2t.net/addgene:185476 ; RRID:Addgene_185476)

  • For your References section:

    Mutation-specific reporter for optimization and enrichment of prime editing. Schene IF, Joore IP, Baijens JHL, Stevelink R, Kok G, Shehata S, Ilcken EF, Nieuwenhuis ECM, Bolhuis DP, van Rees RCM, Spelier SA, van der Doef HPJ, Beekman JM, Houwen RHJ, Nieuwenhuis EES, Fuchs SA. Nat Commun. 2022 Mar 1;13(1):1028. doi: 10.1038/s41467-022-28656-3. 10.1038/s41467-022-28656-3 PubMed 35232966
Related items:
Commonly requested with: