-
PurposeFluorescent reporter for a Y66H mutation to convert a GFP to BFP.
-
Depositing Lab
-
Depositing OrganizationUniversity Medical Centre Utrecht
Located in the Netherlands -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 185477 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 185477-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 185477-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepmGFP-P2A-K0-P2A-RFP
-
Backbone manufacturerRamanujan Hegde
- Backbone size w/o insert (bp) 5964
- Total vector size (bp) 5986
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP-Y66-editing-site
-
SpeciesSynthetic
-
Insert Size (bp)46
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site Acc65I (not destroyed)
- 5′ sequencing primer atgtggcgattctacacagaag
- 3′ sequencing primer ttggtcaccttcagcttgg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The reporter can be used in combination with pegRNA-GFP>BFP_Y66H-NGG with any type of prime editor. This pegRNA does not edit the human genome, therefore the combination of this reporter and the corresponding pegRNA can be cotransfected with your own pegRNA of interest to enrich for prime edited cells. Editing on the reporter will result in mCherry fluorescence.
DNA (Catalog # 185477-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 185477-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
fluoPEER-GFP>BFP was a gift from Sabine Fuchs (Addgene plasmid # 185477 ; http://n2t.net/addgene:185477 ; RRID:Addgene_185477) -
For your References section:
Mutation-specific reporter for optimization and enrichment of prime editing. Schene IF, Joore IP, Baijens JHL, Stevelink R, Kok G, Shehata S, Ilcken EF, Nieuwenhuis ECM, Bolhuis DP, van Rees RCM, Spelier SA, van der Doef HPJ, Beekman JM, Houwen RHJ, Nieuwenhuis EES, Fuchs SA. Nat Commun. 2022 Mar 1;13(1):1028. doi: 10.1038/s41467-022-28656-3. 10.1038/s41467-022-28656-3 PubMed 35232966