ATP1A1_G4_Q118R_Std_BFP-to-EGFP_Dual_epegRNA_tevopreQ1
(Plasmid
#187459)
-
PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 pegRNA and EBFP_To_EGFP epegRNA (tevopreq1) from two independent U6 promoters.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187459 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepU6-tevopreq1-GG-acceptor
- Backbone size w/o insert (bp) 3041
- Total vector size (bp) 2738
-
Vector typeMammalian Expression, CRISPR ; Prime editing
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATP1A1 G4 Q118R pegRNA + EBFP to EGFP epegRNA (tevopreq1)
-
gRNA/shRNA sequenceGTTCCTCTTCTGTAGCAGCT and GGCTGAAGCACTGCACGCCG
-
SpeciesH. sapiens (human)
-
Entrez GeneATP1A1 (a.k.a. CMT2DD, HOMGSMR2)
- Promoter Tandem U6 promoters
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer CAGGGTTATTGTCTCATGAGCGG
- 3′ sequencing primer GGGAAACGCCTGGTATCTTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Control epegRNA vector derived from ATP1A1_G4_Q118R_Std_Dual_epegRNA. This vector can be used as a positive control for prime editing to co-target ATP1A1 (Q118R) and EBFP to perform coselection for EBFP to EGFP conversion. This vector is an optimized version of ATP1A1_G4_Q118R_EBFP_to_EGFP_Dual_pegRNA in which the EBFP pegRNA has been replaced by an engineered pegRNA (epegRNA - tevopreq1).
Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ATP1A1_G4_Q118R_Std_BFP-to-EGFP_Dual_epegRNA_tevopreQ1 was a gift from Yannick Doyon (Addgene plasmid # 187459 ; http://n2t.net/addgene:187459 ; RRID:Addgene_187459) -
For your References section:
Marker-free co-selection for successive rounds of prime editing in human cells. Levesque S, Mayorga D, Fiset JP, Goupil C, Duringer A, Loiselle A, Bouchard E, Agudelo D, Doyon Y. Nat Commun. 2022 Oct 7;13(1):5909. doi: 10.1038/s41467-022-33669-z. 10.1038/s41467-022-33669-z PubMed 36207338