cmv-mCherry-10xPP7
(Plasmid
#185796)
-
PurposemCherry labeled with 10xPP7
-
Depositing Lab
-
Depositing OrganizationUniversity of Pittsburgh (University, School of Medicine, and Cancer Institute)
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 185796 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 185796-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 185796-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepKAN
- Backbone size w/o insert (bp) 4718
- Total vector size (bp) 6534
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namecmv-mCherry-10xPP7
-
SpeciesSynthetic
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer T7
- 3′ sequencing primer AGATCTTCATGTCTGCTCGAAGCGGAAGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 185796-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 185796-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
cmv-mCherry-10xPP7 was a gift from Robin Lee (Addgene plasmid # 185796 ; http://n2t.net/addgene:185796 ; RRID:Addgene_185796) -
For your References section:
Long-term imaging of individual mRNA molecules in living cells. Guo Y, Lee REC. Cell Rep Methods. 2022 May 25;2(6):100226. doi: 10.1016/j.crmeth.2022.100226. eCollection 2022 Jun 20. 10.1016/j.crmeth.2022.100226 PubMed 35784652