pPP7CP-myc-T2A-tagRFP
(Plasmid
#140262)
-
PurposeExpresses PP7CP in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140262 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepIRES2 DsRed-Express
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCoat protein of bacteriphage PP7
-
Alt namePP7CP
- Promoter CMV
-
Tag
/ Fusion Protein
- myc-T2A-tagRFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CMV Forward
- 3′ sequencing primer CTTTATTTGTAACCATTATAAGCTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
CDS of PP7CP (amplified from pPP7_mCherry, ID: 61763) was inserted between SalI and BamHI sites of pTAPmyc-T2A-tagRFP (ID: 140278).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPP7CP-myc-T2A-tagRFP was a gift from Hirohide Saito (Addgene plasmid # 140262 ; http://n2t.net/addgene:140262 ; RRID:Addgene_140262) -
For your References section:
Orthogonal Protein-Responsive mRNA Switches for Mammalian Synthetic Biology. Ono H, Kawasaki S, Saito H. ACS Synth Biol. 2020 Jan 17;9(1):169-174. doi: 10.1021/acssynbio.9b00343. Epub 2019 Dec 13. 10.1021/acssynbio.9b00343 PubMed 31765565