Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pU1A_full-myc-T2A-tagRFP
(Plasmid #140264)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 140264 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pIRES2 DsRed-Express
  • Backbone manufacturer
    Clontech
  • Vector type
    Mammalian Expression, Synthetic Biology
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    U1A
  • Species
    H. sapiens (human)
  • Promoter CMV
  • Tag / Fusion Protein
    • myc-T2A-tagRFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CMV Forward
  • 3′ sequencing primer CTTTATTTGTAACCATTATAAGCTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

CDS of WT U1A was inserted between SalI and BamHI sites of pTAPmyc-T2A-tagRFP (ID: 140278).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pU1A_full-myc-T2A-tagRFP was a gift from Hirohide Saito (Addgene plasmid # 140264 ; http://n2t.net/addgene:140264 ; RRID:Addgene_140264)
  • For your References section:

    Orthogonal Protein-Responsive mRNA Switches for Mammalian Synthetic Biology. Ono H, Kawasaki S, Saito H. ACS Synth Biol. 2020 Jan 17;9(1):169-174. doi: 10.1021/acssynbio.9b00343. Epub 2019 Dec 13. 10.1021/acssynbio.9b00343 PubMed 31765565