pL7Ae-myc-T2A-tagRFP
(Plasmid
#140263)
-
PurposeExpresses L7Ae in mammalian cells
-
Depositing Lab
-
Depositing OrganizationKyoto University, Center for iPS Cell Research and Application
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140263 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 140263-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 140263-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepIRES2 DsRed-Express
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameL7Ae
- Promoter CMV
-
Tag
/ Fusion Protein
- myc-T2A-tagRFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CMV Forward
- 3′ sequencing primer CTTTATTTGTAACCATTATAAGCTGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
CDS of L7Ae was inserted between SalI and BamHI sites of pTAPmyc-T2A-tagRFP (ID: 140278).
DNA (Catalog # 140263-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 140263-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pL7Ae-myc-T2A-tagRFP was a gift from Hirohide Saito (Addgene plasmid # 140263 ; http://n2t.net/addgene:140263 ; RRID:Addgene_140263) -
For your References section:
Orthogonal Protein-Responsive mRNA Switches for Mammalian Synthetic Biology. Ono H, Kawasaki S, Saito H. ACS Synth Biol. 2020 Jan 17;9(1):169-174. doi: 10.1021/acssynbio.9b00343. Epub 2019 Dec 13. 10.1021/acssynbio.9b00343 PubMed 31765565
