pdCas12a(RuvC)
(Plasmid
#186447)
-
PurposeEncodes catalytically inactive Cas12a (D917A, E1006A) from F. novicida (type V-A)
-
Depositing Lab
-
Depositing OrganizationWageningen University, Department Agrotechnology & Food Sciences
Located in the Netherlands -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186447 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 186447-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 186447-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepACYC-duet
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namedCas12a
-
Alt nameCpf1
-
SpeciesF. Novicida
-
MutationD917A, E1006A
- Promoter T7
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TGCGACTCCTGCATTAGGAAAT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 186447-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 186447-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pdCas12a(RuvC) was a gift from John van der Oost (Addgene plasmid # 186447 ; http://n2t.net/addgene:186447 ; RRID:Addgene_186447) -
For your References section:
Adaptation by Type V-A and V-B CRISPR-Cas Systems Demonstrates Conserved Protospacer Selection Mechanisms Between Diverse CRISPR-Cas Types. Wu WY, Jackson SA, Almendros C, Haagsma AC, Yilmaz S, Gort G, van der Oost J, Brouns SJJ, Staals RHJ. CRISPR J. 2022 Aug;5(4):536-547. doi: 10.1089/crispr.2021.0150. Epub 2022 Jul 12. 10.1089/crispr.2021.0150 PubMed 35833800