Arl6ip1-mEmerald
(Plasmid
#186965)
-
PurposeExpress Arl6ip1 with C-terminus mEmerald
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Berkeley
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186965 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 186965-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 186965-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5345
- Total vector size (bp) 6698
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameARL6IP1
-
Alt nameAIP1; ARMER; SPG61; ARL6IP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)609
-
GenBank IDNM_015161.3 NM_001313858.1
-
Entrez GeneARL6IP1 (a.k.a. AIP1, ARL6IP, ARMER, SPG61)
- Promoter CMV Promoter
-
Tag
/ Fusion Protein
- mEmerald (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer tagaaggcacagtcgagg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMyc-DDK-Arl6ip1(OriGene, RC201681)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 186965-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 186965-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Arl6ip1-mEmerald was a gift from Ke Xu (Addgene plasmid # 186965 ; http://n2t.net/addgene:186965 ; RRID:Addgene_186965) -
For your References section:
The endoplasmic reticulum adopts two distinct tubule forms. Wang B, Zhao Z, Xiong M, Yan R, Xu K. Proc Natl Acad Sci U S A. 2022 May 3;119(18):e2117559119. doi: 10.1073/pnas.2117559119. Epub 2022 Apr 26. 10.1073/pnas.2117559119 PubMed 35471903