-
PurposeMitochondria-targeted genetically encoded hydrogen peroxide indicator with red fluorescence.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60247 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepC1
- Backbone size w/o insert (bp) 3931
- Total vector size (bp) 5557
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHyPerRed-mito
-
SpeciesSynthetic
-
Insert Size (bp)1626
- Promoter CMV
-
Tag
/ Fusion Protein
- Mitochondrial targeting signal (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ggtgggaggtctatataag
- 3′ sequencing primer cctctacaaatgtggtatgg (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC1-HyPerRed-mito was a gift from Vsevolod Belousov (Addgene plasmid # 60247 ; http://n2t.net/addgene:60247 ; RRID:Addgene_60247) -
For your References section:
Red fluorescent genetically encoded indicator for intracellular hydrogen peroxide. Ermakova YG, Bilan DS, Matlashov ME, Mishina NM, Markvicheva KN, Subach OM, Subach FV, Bogeski I, Hoth M, Enikolopov G, Belousov VV. Nat Commun. 2014 Oct 21;5:5222. doi: 10.1038/ncomms6222. 10.1038/ncomms6222 PubMed 25330925