Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #109026)


Item Catalog # Description Quantity Price (USD)
Plasmid 109026 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Michael Rape
  • Backbone size w/o insert (bp) 9005
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418) ; GFP

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    RETREG1 (a.k.a. FAM134B, JK-1, JK1)
  • Promoter EIF-1a promoter
  • Tag / Fusion Protein
    • eGFP (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer AGCCTCAGACAGTGGTTCAA
  • 3′ sequencing primer agcagcgtatccacatagcgt
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-X1-Neo-GFP-FAM134B was a gift from Jacob Corn (Addgene plasmid # 109026 ; ; RRID:Addgene_109026)
  • For your References section:

    Atlastins remodel the endoplasmic reticulum for selective autophagy. Liang JR, Lingeman E, Ahmed S, Corn JE. J Cell Biol. 2018 Aug 24. pii: jcb.201804185. doi: 10.1083/jcb.201804185. 10.1083/jcb.201804185 PubMed 30143524