pLKO.1-puro-shFAM134B
(Plasmid
#109013)
-
Purposeshort-hairpin knockdown of targeted gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 109013 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO.1 puro
-
Backbone manufacturerBob Weinberg, Addgene #8453
- Backbone size w/o insert (bp) 7032
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshFAM134B
-
Alt nameshRetReg1
-
gRNA/shRNA sequenceGAGGTATCCTGGACTGATAAT
-
SpeciesH. sapiens (human)
-
Entrez GeneRETREG1 (a.k.a. FAM134B, JK-1, JK1)
- Promoter hU6 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-puro-shFAM134B was a gift from Jacob Corn (Addgene plasmid # 109013 ; http://n2t.net/addgene:109013 ; RRID:Addgene_109013) -
For your References section:
Atlastins remodel the endoplasmic reticulum for selective autophagy. Liang JR, Lingeman E, Ahmed S, Corn JE. J Cell Biol. 2018 Aug 24. pii: jcb.201804185. doi: 10.1083/jcb.201804185. 10.1083/jcb.201804185 PubMed 30143524