CMV-NFIB-T2A-miRFP670
(Plasmid
#187222)
-
PurposeExpresses human NFIB and miRFP670 via T2A linker under control of a CMV promoter.
-
Depositing Lab
-
Depositing OrganizationUniversity of Toronto
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 187222 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 187222-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 187222-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.3-TOPO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 6390
- Total vector size (bp) 7650
-
Modifications to backboneInserted T2A-miRFP670 at 3' terminal of MCS.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNuclear Factor I B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1260
-
GenBank IDNM_005596
-
Entrez GeneNFIB (a.k.a. CTF, HMGIC/NFIB, MACID, NF-I/B, NF1-B, NFI-B, NFI-RED, NFIB2, NFIB3)
- Promoter CMV
-
Tag
/ Fusion Protein
- Inserted T2A-miRFP670 at 3' terminal of MCS. (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAGAAGACACCGGGACCGAT
- 3′ sequencing primer GGATTCTCCTCCACGTCACC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byNFIB was subcloned from Addgene Plasmid #172303 (pIVTR(T7A)-NFIB from Patrik Verstreken)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 187222-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 187222-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-NFIB-T2A-miRFP670 was a gift from Jennifer Mitchell (Addgene plasmid # 187222 ; http://n2t.net/addgene:187222 ; RRID:Addgene_187222) -
For your References section:
Epigenetic reprogramming of a distal developmental enhancer cluster drives SOX2 overexpression in breast and lung adenocarcinoma. Abatti LE, Lado-Fernandez P, Huynh L, Collado M, Hoffman MM, Mitchell JA. Nucleic Acids Res. 2023 Sep 22:gkad734. doi: 10.1093/nar/gkad734. 10.1093/nar/gkad734 PubMed 37738673
