ATP1A1_G4_Q118R_Std_Dual_epegRNA_tevopreQ1
(Plasmid #187454)

• Purpose: Coselection for prime editing in human cells. Vector for tandem expression of ATP1A1 Q118R-G4 pegRNA with a user-specified epegRNA. pU6-tevopreq1-GG-acceptor-like plasmid
• Depositing Lab: Yannick Doyon
• Depositing Organization: Universite Laval
  Located in Canada
• Publication: Levesque et al Nat Commun. 2022 Oct 7;13(1):5909. doi: 10.1038/s41467-022-33669-z.

Backbone

• Vector backbone: pU6-tevopreq1-GG-acceptor
• Backbone size w/o insert (bp): 3041
• Total vector size (bp): 3438
• Vector type: Mammalian Expression, CRISPR ; Prime editing

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ATP1A1 G4 Q118R pegRNA
• Species: H. sapiens (human)
• Entrez Gene: ATP1A1 (a.k.a. CMT2DD, HOMGSMR2)
• Promoter: Tandem U6 promoters

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsrGI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: CAGGGTTATTGTCTCATGAGCGG
• 3′ sequencing primer: GGGAAACGCCTGGTATCTTT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Prime editing vector derived from pU6-tevopreq1-GG-acceptor. See Nelson et al. Nature Biotechnology (2021) for the detailed epegRNA (tevopreq1) cloning protocol to target your gene of interest. False-positive colonies will appear pink or red if the RFP insert has not been replaced by the new epegRNA cassette.

Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.

DNA (Catalog # 187454-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 187454-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.