pKL2315
(Plasmid #187876)

• Purpose: Expresses Cre recombinase.
• Depositing Lab: Kan Wang
• Publication: Aliu et al Plant Biotechnol J. 2022 Jun 11. doi: 10.1111/pbi.13872.

Backbone

• Vector backbone: pTF505
• Backbone manufacturer: Keunsub Lee
• Backbone size w/o insert (bp): 6149
• Total vector size (bp): 9194
• Modifications to backbone: Cre recombinase and sacB expression cassettes were cloned.
• Vector type: Bacterial Expression, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cre recombinase
• Insert Size (bp): 1032
• GenBank ID: MF405193.1
• Promoter: J23107

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: CAACACATGAGCGAAACCCT
• 3′ sequencing primer: CTATAGCAGCGGAGGGGTTG

Resource Information

• Supplemental Documents:
  • pKL2315.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note: Plasmid contains a R139S mutation in Cre recombinase. This mutation is not known to affect plasmid function.