Skip to main content

pKL123
(Plasmid #187889)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187889 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 187889-D50 50 μg of DNA in Tris buffer $495
DNA 187889-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pUCM
  • Backbone size w/o insert (bp) 8700
  • Total vector size (bp) 11809
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NFIA-SOX9
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3100
  • GenBank ID
    ENST0000040349 ENST00000245479
  • Entrez Gene
    SOX9 (a.k.a. CMD1, CMPD1, ENH13, SRA1, SRXX2, SRXY10, TESCO)
  • Entrez Gene
    NFIA (a.k.a. BRMUTD, C1DELp32p31, CTF, DEL1P32P31, NF-I/A, NF1-A, NFI-A, NFI-L)
  • Promoter TRE3G

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AflII (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKL123 was a gift from Martin Kampmann (Addgene plasmid # 187889 ; http://n2t.net/addgene:187889 ; RRID:Addgene_187889)
  • For your References section:

    CRISPRi screens in human iPSC-derived astrocytes elucidate regulators of distinct inflammatory reactive states. Leng K, Rose IVL, Kim H, Xia W, Romero-Fernandez W, Rooney B, Koontz M, Li E, Ao Y, Wang S, Krawczyk M, Tcw J, Goate A, Zhang Y, Ullian EM, Sofroniew MV, Fancy SPJ, Schrag MS, Lippmann ES, Kampmann M. Nat Neurosci. 2022 Nov;25(11):1528-1542. doi: 10.1038/s41593-022-01180-9. Epub 2022 Oct 27. 10.1038/s41593-022-01180-9 PubMed 36303069