Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

AAVS1-TALEN-L
(Plasmid #59025)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 59025 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTALEN
  • Backbone manufacturer
    Feng Zhang Lab
  • Backbone size w/o insert (bp) 8000
  • Total vector size (bp) 8118
  • Vector type
    Mammalian Expression, AAV, TALEN
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AAVS1-TALEN-L
  • Species
    Synthetic
  • Insert Size (bp)
    3012
  • Promoter CMV
  • Tags / Fusion Proteins
    • 3xFlag (N terminal on insert)
    • NLS (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CCAGTTGCTGAAGATCGCGAAGC
  • 3′ sequencing primer TGCCACTCGATGTGATGTCCTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1-TALEN-L was a gift from Danwei Huangfu (Addgene plasmid # 59025 ; http://n2t.net/addgene:59025 ; RRID:Addgene_59025)
  • For your References section:

    An iCRISPR Platform for Rapid, Multiplexable, and Inducible Genome Editing in Human Pluripotent Stem Cells. Gonzalez F, Zhu Z, Shi ZD, Lelli K, Verma N, Li QV, Huangfu D. Cell Stem Cell. 2014 Jun 11. pii: S1934-5909(14)00205-7. doi: 10.1016/j.stem.2014.05.018. 10.1016/j.stem.2014.05.018 PubMed 24931489