Skip to main content

pSLPB2B-ER50-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
(Plasmid #187948)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187948 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pSLPB2-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
  • Backbone size w/o insert (bp) 11406
  • Total vector size (bp) 12190
  • Vector type
    Mammalian Expression, CRISPR, Synthetic Biology
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ER50-SpdCas9-tagRFPt-P2A-tagBFP
  • Alt name
    S. pyogenes Cas9 (D10A; N863A)
  • Alt name
    ER50 degron domain
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    795
  • Mutation
    6 mutations, T371A, L384M, M421G, G521R, Y537S, N519S
  • Tag / Fusion Protein
    • GGS linker (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGCCTTGCCCTGTCACTTACAGC
  • 3′ sequencing primer CAGCCGGTGGGCATCAAGCATTT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The ER50 degron domain was amplified from pBMN ER50-YFP, a gift from Thomas Wandless (Addgene plasmid # 37259 ; http://n2t.net/addgene:37259 ; RRID:Addgene_37259).

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLPB2B-ER50-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin was a gift from Edda Schulz (Addgene plasmid # 187948 ; http://n2t.net/addgene:187948 ; RRID:Addgene_187948)
  • For your References section:

    CasTuner is a degron and CRISPR/Cas-based toolkit for analog tuning of endogenous gene expression. Noviello G, Gjaltema RAF, Schulz EG. Nat Commun. 2023 Jun 3;14(1):3225. doi: 10.1038/s41467-023-38909-4. 10.1038/s41467-023-38909-4 PubMed 37270532