pSin_EF1a_tagBFP_P2A_NLS_pMag_CreC60_IRES_PuroR
(Plasmid
#176311)
-
PurposeExpresses NLS-pMag-CreC60 with tagBFP marker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176311 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSin-EF1a
- Backbone size w/o insert (bp) 6288
- Total vector size (bp) 9696
-
Vector typeMammalian Expression, Lentiviral, Synthetic Biology
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametagBFP_P2A_NLS_pMag_CreC60_IRES_PuroR
-
SpeciesSynthetic
-
Insert Size (bp)3408
- Promoter human EF1alpha
-
Tag
/ Fusion Protein
- tagBFP
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctcaagcctcagacagtggttcaa
- 3′ sequencing primer gggagaggggcggaattggc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSin_EF1a_tagBFP_P2A_NLS_pMag_CreC60_IRES_PuroR was a gift from Yingxiao Wang (Addgene plasmid # 176311 ; http://n2t.net/addgene:176311 ; RRID:Addgene_176311) -
For your References section:
An AND-Gated Drug and Photoactivatable Cre-loxP System for Spatiotemporal Control in Cell-Based Therapeutics. Allen ME, Zhou W, Thangaraj J, Kyriakakis P, Wu Y, Huang Z, Ho P, Pan Y, Limsakul P, Xu X, Wang Y. ACS Synth Biol. 2019 Oct 18;8(10):2359-2371. doi: 10.1021/acssynbio.9b00175. Epub 2019 Oct 8. 10.1021/acssynbio.9b00175 PubMed 31592660